16s rdna gene-based Search Results


99
ATCC 16s rdna gene sequences
16s Rdna Gene Sequences, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rdna gene sequences/product/ATCC
Average 99 stars, based on 1 article reviews
16s rdna gene sequences - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
Zymo Research 16s rdna dna chromosome
16s Rdna Dna Chromosome, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rdna dna chromosome/product/Zymo Research
Average 99 stars, based on 1 article reviews
16s rdna dna chromosome - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
Thermo Fisher 16s ribosomal dna sequence
16s Ribosomal Dna Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s ribosomal dna sequence/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
16s ribosomal dna sequence - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
Jumpstart Fertility 16s rdna-based community profiling
16s Rdna Based Community Profiling, supplied by Jumpstart Fertility, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rdna-based community profiling/product/Jumpstart Fertility
Average 90 stars, based on 1 article reviews
16s rdna-based community profiling - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

99
ATCC saur tacaaactctcgtggtgtga
Saur Tacaaactctcgtggtgtga, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/saur tacaaactctcgtggtgtga/product/ATCC
Average 99 stars, based on 1 article reviews
saur tacaaactctcgtggtgtga - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

99
Illumina Inc truseq nano dna lt library prep kit sequencing platform
Truseq Nano Dna Lt Library Prep Kit Sequencing Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/truseq nano dna lt library prep kit sequencing platform/product/Illumina Inc
Average 99 stars, based on 1 article reviews
truseq nano dna lt library prep kit sequencing platform - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
Lawrence Livermore National Security LLC 16s ribosomal dna sequences
16s Ribosomal Dna Sequences, supplied by Lawrence Livermore National Security LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s ribosomal dna sequences/product/Lawrence Livermore National Security LLC
Average 90 stars, based on 1 article reviews
16s ribosomal dna sequences - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
First BASE Laboratories 16s rdna gene sequencing
16s Rdna Gene Sequencing, supplied by First BASE Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rdna gene sequencing/product/First BASE Laboratories
Average 90 stars, based on 1 article reviews
16s rdna gene sequencing - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Federation of European Neuroscience Societies 16s rdna genes
16s Rdna Genes, supplied by Federation of European Neuroscience Societies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rdna genes/product/Federation of European Neuroscience Societies
Average 90 stars, based on 1 article reviews
16s rdna genes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Refgen Technologies INC 16s ribosomal dna sequence
16s Ribosomal Dna Sequence, supplied by Refgen Technologies INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s ribosomal dna sequence/product/Refgen Technologies INC
Average 90 stars, based on 1 article reviews
16s ribosomal dna sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
NCIMB Ltd 16s ribosomal dna sequence
16s Ribosomal Dna Sequence, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s ribosomal dna sequence/product/NCIMB Ltd
Average 90 stars, based on 1 article reviews
16s ribosomal dna sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Oxford Nanopore 16s rdna amplicon sequencing
16s Rdna Amplicon Sequencing, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/16s rdna amplicon sequencing/product/Oxford Nanopore
Average 90 stars, based on 1 article reviews
16s rdna amplicon sequencing - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results