99
|
ATCC
16s rdna gene sequences 16s Rdna Gene Sequences, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rdna gene sequences/product/ATCC Average 99 stars, based on 1 article reviews
16s rdna gene sequences - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
99
|
Zymo Research
16s rdna dna chromosome 16s Rdna Dna Chromosome, supplied by Zymo Research, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rdna dna chromosome/product/Zymo Research Average 99 stars, based on 1 article reviews
16s rdna dna chromosome - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
99
|
Thermo Fisher
16s ribosomal dna sequence 16s Ribosomal Dna Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s ribosomal dna sequence/product/Thermo Fisher Average 99 stars, based on 1 article reviews
16s ribosomal dna sequence - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
90
|
Jumpstart Fertility
16s rdna-based community profiling 16s Rdna Based Community Profiling, supplied by Jumpstart Fertility, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rdna-based community profiling/product/Jumpstart Fertility Average 90 stars, based on 1 article reviews
16s rdna-based community profiling - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
99
|
ATCC
saur tacaaactctcgtggtgtga Saur Tacaaactctcgtggtgtga, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/saur tacaaactctcgtggtgtga/product/ATCC Average 99 stars, based on 1 article reviews
saur tacaaactctcgtggtgtga - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
99
|
Illumina Inc
truseq nano dna lt library prep kit sequencing platform Truseq Nano Dna Lt Library Prep Kit Sequencing Platform, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/truseq nano dna lt library prep kit sequencing platform/product/Illumina Inc Average 99 stars, based on 1 article reviews
truseq nano dna lt library prep kit sequencing platform - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
90
|
Lawrence Livermore National Security LLC
16s ribosomal dna sequences 16s Ribosomal Dna Sequences, supplied by Lawrence Livermore National Security LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s ribosomal dna sequences/product/Lawrence Livermore National Security LLC Average 90 stars, based on 1 article reviews
16s ribosomal dna sequences - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
First BASE Laboratories
16s rdna gene sequencing 16s Rdna Gene Sequencing, supplied by First BASE Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rdna gene sequencing/product/First BASE Laboratories Average 90 stars, based on 1 article reviews
16s rdna gene sequencing - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Federation of European Neuroscience Societies
16s rdna genes 16s Rdna Genes, supplied by Federation of European Neuroscience Societies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rdna genes/product/Federation of European Neuroscience Societies Average 90 stars, based on 1 article reviews
16s rdna genes - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Refgen Technologies INC
16s ribosomal dna sequence 16s Ribosomal Dna Sequence, supplied by Refgen Technologies INC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s ribosomal dna sequence/product/Refgen Technologies INC Average 90 stars, based on 1 article reviews
16s ribosomal dna sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
NCIMB Ltd
16s ribosomal dna sequence 16s Ribosomal Dna Sequence, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s ribosomal dna sequence/product/NCIMB Ltd Average 90 stars, based on 1 article reviews
16s ribosomal dna sequence - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Oxford Nanopore
16s rdna amplicon sequencing 16s Rdna Amplicon Sequencing, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/16s rdna amplicon sequencing/product/Oxford Nanopore Average 90 stars, based on 1 article reviews
16s rdna amplicon sequencing - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |